Primer Sets

Amp. Method Set Name Source Organism Oligos Subscription
LAMP Dudley As1e Source SARS-CoV-2 As1e_F3: CGGTGGACAAATTGTCAC, As1e_FIP: TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGG, As1e_LF: TTACAAGCTTAAAGAATGTCTGAACACT, As1e_LB: TTGAATTTAGGTGAAACATTTGTCACG, As1e_BIP: TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCC, As1e_B3: CTTCTCTGGATTTAACACACTT Log in to subscribe
qPCR China CDC Source SARS-CoV-2 CNCDC-ORF1ab-F: CCCTGTGGGTTTTACACTTAA, CNCDC-ORF1ab-P: CCGTCTGCGGTATGTGGAAAGGTTATGG, CNCDC-ORF1ab-R: ACGATTGTGCATCAGCTGA, CNCDC-N-F: GGGGAACTTCTCCTGCTAGAAT, CNCDC-N-P: TTGCTGCTGCTTGACAGATT, CNCDC-N-R: CAGACATTTTGCTCTCAAGCTG Log in to subscribe
qPCR UtrechtU Source SARS-CoV-2 UtrechtU-UKF-1: ACCTCAAGGTATTGGGAACCT, UtrechtU-UKR-1: CATCACAACCTGGAGCATTG Log in to subscribe
qPCR IP2 Source SARS-CoV-2 nCoV_IP2-12669Fw: ATGAGCTTAGTCCTGTTG, nCoV_IP2-12696bProbe: AGATGTCTTGTGCTGCCGGTA, nCoV_IP2-12759Rv: CTCCCTTTGTTGTGTTGT Log in to subscribe
qPCR Thailand NIH SARS-CoV-2 WH-NIC N-F: CGTTTGGTGGACCCTCAGAT, WH-NIC N-P: CAACTGGCAGTAACCA, WH-NIC N-R: CCCCACTGCGTTCTCCATT Log in to subscribe
qPCR Japan NIID SARS-CoV-2 NIID_2019-nCOV_N_F: ATGTCGCGCATTGGCATGGA, NIID_2019-nCOV_N_P: ATGTCGCGCATTGGCATGGA, NIID_2019-nCOV_N_R: TGGCAGCTGTGTAGGTCAACB Log in to subscribe
qPCR Hong Kong University SARS-CoV-2 HKU-ORF1b-nsp14-F: TGGGGYTTTACRGGTAACCT, HKU-ORF1b-nsp14-P: TAGTTGTGATGCWATCATGACTAG, HKU-ORF1b-nsp14-R: AACRCGCTTAACAAAGCACTC, HKU-N-F: TAATCAGACAAGGAACTGATTA, HKU-N-P: GCAAATTGTGCAATTTGCGG, HKU-N-R: CGAAGGTGTGACTTCCATG Log in to subscribe
qPCR Charité Hospital Source SARS-CoV-2 E_Sarbeco_F: ACAGGTACGTTAATAGTTAATAGCGT, E_Sarbeco_P: ACACTAGCCATCCTTACTGCGCTTCG, E_Sarbeco_R: ATATTGCAGCAGTACGCACACA, N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_P: ACTTCCTCAAGGAACAACATTGCCA, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG Log in to subscribe
qPCR NEB Luna qPCR/CDC Source SARS-CoV-2 N1-F: GACCCCAAAATCAGCGAAAT, N1-Probe: ACCCCGCATTACGTTTGGTGGACC, N1-R: TCTGGTTACTGCCAGTTGAATCTG, N2-F: TTACAAACATTGGCCGCAAA, N2-Probe: ACAATTTGCCCCCAGCGCTTCAG, N2-R: GCGCGACATTCCGAAGAA Log in to subscribe
qPCR Saliva Direct/CDC N1 Source SARS-CoV-2 2019-nCoV_N1-F: GACCCCAAAATCAGCGAAAT, 2019-nCoV_N1-P: ACCCCGCATTACGTTTGGTGGACC, 2019-nCoV_N1-R: TCTGGTTACTGCCAGTTGAATCTG Log in to subscribe
qPCR Mason/iCare SARS-CoV-2 RdRp F: CTATAGATTAGCTAATGAGTGTGCTC, RdRp R: ATCGGCAATTTTGTTACCATCAG, N F: TCCAGAACAAACCCAAGGAA, N R: TCCAGAACAAACCCAAGGAA Log in to subscribe
LAMP NEB LAMP (N2+E1) Source SARS-CoV-2 E1-F3: TGAGTACGAACTTATGTACTCAT, E1-F2: TCGTTTCGGAAGAGACAG, E1-LF: CGCTATTAACTATTAACG, E1-F1c: ACTTCTTTTTCTTGCTTTCGTGGT, E1-B2: AAGGATGGCTAGTGTAACTAGCAA, E1-LB: GCGCTTCGATTGTGTGCGT, E1-B1c: AGGTTTTACAAGACTCACGT, E1-B3: TTCAGATTTTTAACACGAGAGT, N2-F3: ACCAGGAACTAATCAGACAAG, N2_F2: GAACTGATTACAAACATTGGCC, N2-LF: GGGGGCAAATTGTGCAATTTG, N2_F1c: CGCTTCAGCGTTCTTCGGAA, N2-B2: GTGACTTCCATGCCAATGCG, N2-LB: CTTCGGGAACGTGGTTGACC, N2-B1c: AATTTGATGGCACCTGTGTA, N2-B3: GACTTGATCTTTGAAATTTGGATCT, N2-BIP: CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA, N2-FIP: TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC, E1-FIP: ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG, E1-BIP: TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT Log in to subscribe
LAMP Covid Detective Source SARS-CoV-2 F3: AACACAAGCTTTCGGCAG, F2: CCAAGGAAATTTTGGGGA, LF: TTCCTTGTCTGATTAGTTC, F1: TGCGGCCAATGTTTGTAATCAG, B1: CGCATTGGCATGGAAGTCACT, LB: ACCTTCGGGAACGTGGTT, B2: TTTGATGGCACCTGTGTAG, B3: GAAATTTGGATCTTTGTCATCC, FIP: TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGA, BIP: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG Log in to subscribe
LAMP Broughton N Source SARS-CoV-2 NM F3: AACACAAGCTTTCGGCAG, NM B1: TGCGGCCAATGTTTGTAATCAG, NM LF: TTCCTTGTCTGATTAGTTC, NM B2: CCAAGGAAATTTTGGGGAC, NM F2: CGCATTGGCATGGAAGTCAC, NM LB: ACCTTCGGGAACGTGGTT, NM F1: TTTGATGGCACCTGTGTAG, NM B3: GAAATTTGGATCTTTGTCATCC, NM FIP: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG, NM BIP: TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC Log in to subscribe
LAMP Lamb Orf1A Source SARS-CoV-2 ORF1a-F3: TCCAGATGAGGATGAAGAAGA, ORF1a-F2: AGGTGATTGTGAAGAAGAAGAG, ORF1a-LF: CTCATATTGAGTTGATGGCTCA, ORF1a-F1: GTGCCACTTCTGCTGCTCT, ORF1a-B1: TCAACCTGAAGAAGAGCAAGAA, ORF1a-LB: ACAAACTGTTGGTCAACAAGAC, ORF1a-B2: CTGATTGTCCTCACTGCC, ORF1a-B3: AGTCTGAACAACTGGTGTAAG, E1-LB: GCGCTTCGATTGTGTGCGT, ORF1a-BIP: TCAACCTGAAGAAGAGCAAGAACTGATTGTCCTCACTGCC, E1-LF: CGCTATTAACTATTAACG, E1-BIP: TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTC, E1-FIP: ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGAC, E1-B3: TTCAGATTTTTAACACGAGAGT, ORF1a-FIP: AGAGCAGCAGAAGTGGCACAGGTGATTGTGAAGAAGAAGAG, E1-F3: TGAGTACGAACTTATGTACTCAT Log in to subscribe
qPCR LCA_N2 Source SARS-CoV-2 N2_F: TTACAAACATTGGCCGCAAA, N2_P: ACAATTTGCCCCCAGCGCTTCAG, N2_R: GCGCGACATTCCGAAGAA Log in to subscribe
qPCR Wehi_S Source SARS-CoV-2 S_PCR_Fwd: CAAATCGCTCCAGGGCAAAC, S_PCR_Rev: TGGTGCATGTAGAAGTTCAAAAG Log in to subscribe

New Primer Set