Primer Set: NEB LAMP (N2+E1)


Primers:

Name Locus Category Sequence
E1-F3 E1 F3 TGAGTACGAACTTATGTACTCAT
E1-F2 E1 FIP TCGTTTCGGAAGAGACAG
E1-LF E1 LF CGCTATTAACTATTAACG
E1-F1c E1 FIP ACTTCTTTTTCTTGCTTTCGTGGT
E1-B2 E1 BIP AAGGATGGCTAGTGTAACTAGCAA
E1-LB E1 LB GCGCTTCGATTGTGTGCGT
E1-B1c E1 BIP AGGTTTTACAAGACTCACGT
E1-B3 E1 B3 TTCAGATTTTTAACACGAGAGT
N2-F3 N2 F3 ACCAGGAACTAATCAGACAAG
N2_F2 N2 FIP GAACTGATTACAAACATTGGCC
N2-LF N2 LF GGGGGCAAATTGTGCAATTTG
N2_F1c N2 FIP CGCTTCAGCGTTCTTCGGAA
N2-B2 N2 BIP GTGACTTCCATGCCAATGCG
N2-LB N2 LB CTTCGGGAACGTGGTTGACC
N2-B1c N2 BIP AATTTGATGGCACCTGTGTA
N2-B3 N2 B3 GACTTGATCTTTGAAATTTGGATCT
E1-BIP E1 F3 TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT
E1-FIP E1 FIP ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG
N2-FIP N2 FIP TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC
N2-BIP N2 BIP CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA
All Primer Sets