Primer Set: Lamb Orf1A

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
ORF1a-F3 ORF1a F3 TCCAGATGAGGATGAAGAAGA
ORF1a-F2 ORF1a FIP AGGTGATTGTGAAGAAGAAGAG
ORF1a-LF ORF1a LF CTCATATTGAGTTGATGGCTCA
ORF1a-F1 ORF1a FIP GTGCCACTTCTGCTGCTCT
ORF1a-B1 ORF1a BIP TCAACCTGAAGAAGAGCAAGAA
ORF1a-LB ORF1a LB ACAAACTGTTGGTCAACAAGAC
ORF1a-B2 ORF1a BIP CTGATTGTCCTCACTGCC
ORF1a-B3 ORF1a B3 AGTCTGAACAACTGGTGTAAG
E1-BIP E1 BIP TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTC
E1-F3 E! F3 TGAGTACGAACTTATGTACTCAT
E1-B3 E1 B3 TTCAGATTTTTAACACGAGAGT
E1-FIP E1 FIP ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGAC
ORF1a-FIP ORF1a FIP AGAGCAGCAGAAGTGGCACAGGTGATTGTGAAGAAGAAGAG
E1-LF E1 LF CGCTATTAACTATTAACG
E1-LB E1 LB GCGCTTCGATTGTGTGCGT
ORF1a-BIP ORF1a BIP TCAACCTGAAGAAGAGCAAGAACTGATTGTCCTCACTGCC
All Primer Sets