Primer Set: Broughton N

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
NM F3 N2 F3 AACACAAGCTTTCGGCAG
NM B1 N2 BIP TGCGGCCAATGTTTGTAATCAG
NM LF N2 LF TTCCTTGTCTGATTAGTTC
NM B2 N2 BIP CCAAGGAAATTTTGGGGAC
NM F2 N2 FIP CGCATTGGCATGGAAGTCAC
NM LB N2 LB ACCTTCGGGAACGTGGTT
NM F1 N2 FIP TTTGATGGCACCTGTGTAG
NM B3 N2 B3 GAAATTTGGATCTTTGTCATCC
NM BIP N2 BIP TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC
NM FIP N2 FIP CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG
All Primer Sets