Primer Set: Covid Detective

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
F3 N2 F3 AACACAAGCTTTCGGCAG
F2 N2 FIP CCAAGGAAATTTTGGGGA
LF N2 LF TTCCTTGTCTGATTAGTTC
F1 N2 FIP TGCGGCCAATGTTTGTAATCAG
B1 N2 BIP CGCATTGGCATGGAAGTCACT
LB N2 LB ACCTTCGGGAACGTGGTT
B2 N2 BIP TTTGATGGCACCTGTGTAG
B3 N2 B3 GAAATTTGGATCTTTGTCATCC
BIP N2 BIP CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG
FIP N2 FIP TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGA
All Primer Sets