Primer Set: UtrechtU


Primers:

Name Locus Category Sequence
UtrechtU-UKF-1 Orf1ab Forward ACCTCAAGGTATTGGGAACCT
UtrechtU-UKR-1 Orf1ab Reverse CATCACAACCTGGAGCATTG
All Primer Sets