Primer Set: IP2

Organism: SARS-CoV-2
Amp. Method: qPCR
Source:

Primers:

Name Locus Category Sequence
nCoV_IP2-12669Fw Orf1 Forward ATGAGCTTAGTCCTGTTG
nCoV_IP2-12696bProbe Orf1 Probe AGATGTCTTGTGCTGCCGGTA
nCoV_IP2-12759Rv Orf1 Reverse CTCCCTTTGTTGTGTTGT
All Primer Sets