Primer Set: CharitƩ Hospital


Primers:

Name Locus Category Sequence
E_Sarbeco_F E Forward ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_P E Probe ACACTAGCCATCCTTACTGCGCTTCG
E_Sarbeco_R E Reverse ATATTGCAGCAGTACGCACACA
N_Sarbeco_F N Forward CACATTGGCACCCGCAATC
N_Sarbeco_P N Probe ACTTCCTCAAGGAACAACATTGCCA
N_Sarbeco_R N Reverse GAGGAACGAGAAGAGGCTTG
All Primer Sets