Primer Set: Japan NIID

Organism: SARS-CoV-2
Amp. Method: qPCR

Primers:

Name Locus Category Sequence
NIID_2019-nCOV_N_F N Forward ATGTCGCGCATTGGCATGGA
NIID_2019-nCOV_N_P N Probe ATGTCGCGCATTGGCATGGA
NIID_2019-nCOV_N_R N Reverse TGGCAGCTGTGTAGGTCAACB
All Primer Sets