Primer Set: China CDC

Organism: SARS-CoV-2
Amp. Method: qPCR

Primers:

Name Locus Category Sequence
CNCDC-ORF1ab-F Orf1 Forward CCCTGTGGGTTTTACACTTAA
CNCDC-ORF1ab-P Orf1 Probe CCGTCTGCGGTATGTGGAAAGGTTATGG
CNCDC-ORF1ab-R Orf1 Reverse ACGATTGTGCATCAGCTGA
CNCDC-N-F N Forward GGGGAACTTCTCCTGCTAGAAT
CNCDC-N-P N Probe TTGCTGCTGCTTGACAGATT
CNCDC-N-R N Reverse CAGACATTTTGCTCTCAAGCTG
All Primer Sets