Primer Set: Thailand NIH

Organism: SARS-CoV-2
Amp. Method: qPCR

Primers:

Name Locus Category Sequence
WH-NIC N-F N Forward CGTTTGGTGGACCCTCAGAT
WH-NIC N-P N Probe CAACTGGCAGTAACCA
WH-NIC N-R N Reverse CCCCACTGCGTTCTCCATT
All Primer Sets