Primer Set: Mason N1

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
N1-F3 N1 F3 TCCAGATGACCAAATTGGCT
N1-F2 N1 FIP GAGCTACCAGACGAATTCG
N1-LF N1 LF TTTCATTTTACCGTCACCACCA
N1-F1c N1 FIP CCTAGGAACTGGGCCAGAAG
N1-B2 N1 BIP TTGGTGTATTCAAGGCTCCCTCA
N1-LB N1 LB TCACATTGGCACCCGCAATC
N1-B1c N1 BIP AAGTTGTAGCACGATTGCA
N1-B3 N1 B3 GTAGAAGCCTTTTGGCAATG
N1-FIP N1 FIP CTTCTGGCCCAGTTCCTAGGGAGCTACCAGACGAATTCG
N1-BIP N1 BIP TGAGGGAGCCTTGAATACACCAAGTTGTAGCACGATTGCA
All Primer Sets