Primer Set: OmniSARS2


Primers:

Name Locus Category Sequence
1ab1917F1 ORF1ab Forward AGAGTTTCTTAGAGACGGTTGG
1ab1977P1 ORF1ab Probe TGTCGGTGGACAAATTGTCACCTGT
1ab2003R1 ORF1ab Reverse TGAACACTCTCCTTAATTTCCTTTG
S1725P1 Spike Probe TGTCCGTGATCCACAGACACTTGAG
S1797R1 Spike Reverse CTGGTTAGAAGTATTTGTTCCTGGT
S1703F1 Spike Forward ACATTGCTGACACTACTGATGC
E22F1 Envelope Forward AGACAGGTACGTTAATAGTTAATAGCG
E84P1 Envelope Probe AGTTACACTAGCCATCCTTACTGCGC
E143R1 Envelope Reverse AAGAAGGTTTTACAAGACTCACGT
All Primer Sets