Primer Set: MasonMar2022

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
F3-4 Orf1ab4 F3 ACAACTAGCTACAGAGAAGC
F2-4 Orf1ab4 FIP TCATCTCGCAAAGGCT
LF-2 Orf1ab2 LF ACCTGAGTTACTGAAGTCA
LF-4 Orf1ab4 LF ACCTGAGTTACTGAAGTCA
F1c-4 Orf1ab4 FIP TTGTGGTGGTTGGTAAAGAACATC
B1c-4 Orf1ab4 BIP AGCTGTTTTGCAGAGTGGTT
LB-4 Orf1ab4 LB GAAAAATGGCATTCCCATC
LB-2 Orf1ab2 LB GAAAAATGGCATTCCCATC
B2-4 Orf1ab4 BIP CCATACAACCCTCAACTTTA
B3-4 Orf1ab4 B3 AGTGTAGTTGTACCACAAGT
N2-F3 N1 F3 GACGTGGTCCAGAACAAAC
N2-F2 N1 FIP TCATCTCGCAAAGGCT
N2-LF N1 LF GGCCAATGTTTGTAATCAGTTC
N2-F1c N1 FIP TTGTGGTGGTTGGTAAAGAACATC
N2-B1c N1 BIP AGCTGTTTTGCAGAGTGGTT
N2-LB N1 LB TCACACCTTCGGGAACGTG
N2-B2 N1 BIP CCATACAACCCTCAACTTTA
N2-B3 N1 B3 GCTTATTCAGCAAAATGACTTG
FIPe-2 Orf1ab2 FIP TGGTGGTTGGTAAAGAACATCAGCATCTCGCAAAGGCTCT
B3-2 Orf1ab2 B3 AGTGTAGTTGTACCACAAGTT
N2-FIP N1 FIP AGAACGCTGAAGCGCTGGGGACCAGGAACTAATCAGAC
F3-2 Orf1ab2 F3 CAGAGAAGCTGCTTGTTG
BIPe-4 Orf1ab4 BIP AGCTGTTTTGCAGAGTGGTTCCATACAACCCTCAACTTTA
N2-BIP N1 BIP CGCGCATTGGCATGGAAGGGATCTTTGTCATCCAATTTGA
FIPe-4 Orf1ab4 FIP TTGTGGTGGTTGGTAAAGAACATCTCATCTCGCAAAGGCT
BIPe-2 Orf1ab2 BIP AACCTCTATCACCTCAGCTGTTTTTGTACCATACAACCCT
All Primer Sets