Primer Set: MasonApr22

Organism: SARS-CoV-2
Amp. Method: LAMP
Source:

Primers:

Name Locus Category Sequence
Orf-1-F3 Orf1ab1 F3 ACTGCACCTCATGGTCATGTT
Orf-1-FIP-2 Orf1ab1 FIP GGTAGCAGAACTCGAAGGC
Orf-1-LF Orf1ab1 LF CACCACTACGACCGTACT
Orf-1-FIP-1 Orf1ab1 FIP GAGGGACAAGGACACCAAGTGT
Orf-1-BIP-1 Orf1ab1 BIP AGTGGCTTACCGCAAGGTTCTT
Orf-1-LB Orf1ab1 LB AAGGAGCTGGTGGCCATA
Orf-1-BIP-2 Orf1ab1 BIP TTTAGATCGGCGCCGTAAC
Orf-1-B3 Orf1ab1 B3 GATCAGTGCCAAGCTCGTC
Orf-4-F3 Orf1ab4 F3 ACAACTAGCTACAGAGAAGC
Orf-4-FIP-2 Orf1ab4 FIP TCATCTCGCAAAGGCTCTCA
Orf-4-LF Orf1ab4 LF ACCTGAGTTACTGAAGTCA
Orf-4-FIP-1 Orf1ab4 FIP TTGTGGTGGTTGGTAAAGAACATC
Orf-4-BIP-1 Orf1ab4 BIP AGCTGTTTTGCAGAGTGGTT
Orf-4-LB Orf1ab4 LB GAAAAATGGCATTCCCATC
Orf-4-BIP-2 Orf1ab4 BIP CCATACAACCCTCAACTTTA
Orf-4-B3 Orf1ab4 B3 AGTGTAGTTGTACCACAAGT
N2-F3 N1 F3 GACGTGGTCCAGAACAAAC
N2-FIP-2 N1 FIP GGACCAGGAACTAATCAGAC
N2-LF N1 LF GGCCAATGTTTGTAATCAGTTC
N2-FIP-1 N1 FIP AGAACGCTGAAGCGCTGG
N2-BIP-1 N1 BIP CGCGCATTGGCATGGAAG
N2-LB N1 LB TCACACCTTCGGGAACGTG
N2-BIP-2 N1 BIP GGATCTTTGTCATCCAATTTGA
N2-B3 N1 B3 GCTTATTCAGCAAAATGACTTG
ACTB-FIP-2 β-actin-2 FIP CATCGAGCACGGCATCGTC
ACTB-LB β-actin-2 LB AGGCCCCCCTGAACCCCAA
ACTB-B3 β-actin-2 B3 TGGGGTGTTGAAGGTCTCAA
ACTB-F3 β-actin-2 F3 GGCATCCTCACCCTGAAGT
ACTB-FIP-1 β-actin-2 FIP GCCACACGCAGCTCATTGTAGA
ACTB-LF β-actin-2 LF GTGTGGTGCCAGATTTTCTCCAT
ACTB-BIP-2 β-actin-2 BIP ATCTTCTCGCGGTTGGCC
ACTB-BIP-1 β-actin-2 BIP AGCACCCCGTGCTGCTGA
All Primer Sets