Primer Set: Dudley As1e


Primers:

Name Locus Category Sequence
As1e_F3 As1e F3 CGGTGGACAAATTGTCAC
As1e_FIP As1e FIP TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGG
As1e_LF As1e LF TTACAAGCTTAAAGAATGTCTGAACACT
As1e_LB As1e LB TTGAATTTAGGTGAAACATTTGTCACG
As1e_BIP As1e BIP TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCC
As1e_B3 As1e B3 CTTCTCTGGATTTAACACACTT
All Primer Sets